ID: 1080763110_1080763119

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1080763110 1080763119
Species Human (GRCh38) Human (GRCh38)
Location 11:35271717-35271739 11:35271757-35271779
Sequence CCTGTAATCCCAGCTGCTCTGGA CGCTTGGGCCTGAGAGACGAAGG
Strand - +
Off-target summary {0: 163, 1: 7257, 2: 117664, 3: 258986, 4: 245143} {0: 1, 1: 0, 2: 11, 3: 177, 4: 2540}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!