ID: 1080802264_1080802274

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1080802264 1080802274
Species Human (GRCh38) Human (GRCh38)
Location 11:35619212-35619234 11:35619257-35619279
Sequence CCTGTCTTACTATCTGGCGCGCC GCCGCCGCTGGCACTGGCTCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 25} {0: 1, 1: 0, 2: 2, 3: 21, 4: 219}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!