ID: 1080864394_1080864401

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1080864394 1080864401
Species Human (GRCh38) Human (GRCh38)
Location 11:36180492-36180514 11:36180544-36180566
Sequence CCTGCGAGGAGAGTGGCGGGAGC CCAGACAGTGAAGCCTTATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 151} {0: 1, 1: 0, 2: 0, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!