ID: 1080888485_1080888486

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1080888485 1080888486
Species Human (GRCh38) Human (GRCh38)
Location 11:36388175-36388197 11:36388190-36388212
Sequence CCAGTGTTTATTTGCTAGCCCAT TAGCCCATATGTTCCTGCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 108} {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!