ID: 1080896661_1080896674

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1080896661 1080896674
Species Human (GRCh38) Human (GRCh38)
Location 11:36453880-36453902 11:36453928-36453950
Sequence CCCAGGCCAAGGGGAGGAGCTTG GCAAGAGGAAGGAGCGTTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 25, 4: 292} {0: 1, 1: 0, 2: 5, 3: 16, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!