ID: 1080997168_1080997171

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1080997168 1080997171
Species Human (GRCh38) Human (GRCh38)
Location 11:37618356-37618378 11:37618383-37618405
Sequence CCTAGAAACTTGTTGAATGGTTG CAAAATACTGATAGTAACATGGG
Strand - +
Off-target summary {0: 11, 1: 100, 2: 614, 3: 2276, 4: 2100} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!