ID: 1081245084_1081245088

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1081245084 1081245088
Species Human (GRCh38) Human (GRCh38)
Location 11:40755984-40756006 11:40756023-40756045
Sequence CCTGTTTCAATCTGACTGGCTTC TGGGTACACAGAAAAACAACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 224} {0: 1, 1: 0, 2: 1, 3: 17, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!