ID: 1081438934_1081438940

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1081438934 1081438940
Species Human (GRCh38) Human (GRCh38)
Location 11:43058812-43058834 11:43058857-43058879
Sequence CCTGGCTCAAGCCAAATATTTCA AATTGTGCCTGGAGCACAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 7, 3: 109, 4: 626}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!