ID: 1081561574_1081561579

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1081561574 1081561579
Species Human (GRCh38) Human (GRCh38)
Location 11:44221805-44221827 11:44221842-44221864
Sequence CCCATTCATTGCAAAATTGTACA CGTGAGTTTCAGGCAGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 228} {0: 1, 1: 0, 2: 0, 3: 11, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!