ID: 1081670382_1081670394

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1081670382 1081670394
Species Human (GRCh38) Human (GRCh38)
Location 11:44939062-44939084 11:44939081-44939103
Sequence CCCCCACTCCCCCACCGCCAGCA AGCAACATCTTGGACCAGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 138, 4: 1275} {0: 1, 1: 0, 2: 2, 3: 10, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!