ID: 1081702367_1081702378

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1081702367 1081702378
Species Human (GRCh38) Human (GRCh38)
Location 11:45159859-45159881 11:45159894-45159916
Sequence CCCTGAAGCTGGTCACAATTGGC CTGCAGAAACAGAATGGGCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 95} {0: 1, 1: 0, 2: 2, 3: 39, 4: 330}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!