ID: 1081708458_1081708463

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1081708458 1081708463
Species Human (GRCh38) Human (GRCh38)
Location 11:45200719-45200741 11:45200734-45200756
Sequence CCAGGGGAGGGTCCCTGCAGACT TGCAGACTGGAGCATCACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 211} {0: 1, 1: 0, 2: 1, 3: 16, 4: 129}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!