ID: 1081719636_1081719638

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1081719636 1081719638
Species Human (GRCh38) Human (GRCh38)
Location 11:45278677-45278699 11:45278701-45278723
Sequence CCATGTATCTGAATTATCTACAA CTGTACCCAAAGAAGGAACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 362} {0: 1, 1: 0, 2: 4, 3: 10, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!