ID: 1081794381_1081794388

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1081794381 1081794388
Species Human (GRCh38) Human (GRCh38)
Location 11:45809556-45809578 11:45809603-45809625
Sequence CCAGGGCACAGCCTGGACCGATC TTGCAAGGTGGAGAGTAGATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 121} {0: 1, 1: 0, 2: 4, 3: 25, 4: 255}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!