ID: 1081914874_1081914878

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1081914874 1081914878
Species Human (GRCh38) Human (GRCh38)
Location 11:46724273-46724295 11:46724299-46724321
Sequence CCCATGAGGGTTGGCAGGTGTGG CACTCGCTAATGCGTCTGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 168} {0: 1, 1: 0, 2: 0, 3: 1, 4: 17}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!