ID: 1081926671_1081926674

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1081926671 1081926674
Species Human (GRCh38) Human (GRCh38)
Location 11:46835313-46835335 11:46835352-46835374
Sequence CCACTAGCAAGGAGCAGACGGCA GTTTCTAAATACCAAGCAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 113} {0: 1, 1: 0, 2: 0, 3: 22, 4: 237}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!