ID: 1081929534_1081929545

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1081929534 1081929545
Species Human (GRCh38) Human (GRCh38)
Location 11:46859186-46859208 11:46859234-46859256
Sequence CCCGGAGGAGGCCCCCCCGTGAG ACTCAGCATCATCCCCAGACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 143} {0: 1, 1: 0, 2: 0, 3: 22, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!