ID: 1081931644_1081931654

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1081931644 1081931654
Species Human (GRCh38) Human (GRCh38)
Location 11:46875656-46875678 11:46875685-46875707
Sequence CCATTCAGGTCAGCAGCCTCAAT CAGAGGAAGGAGAGGGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 236} {0: 1, 1: 2, 2: 17, 3: 267, 4: 2003}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!