ID: 1081935869_1081935876

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1081935869 1081935876
Species Human (GRCh38) Human (GRCh38)
Location 11:46903666-46903688 11:46903697-46903719
Sequence CCCTGGGATGTTGGCCAGGGAGG TAATGGTGGAATTAAAATGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 334} {0: 1, 1: 0, 2: 1, 3: 26, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!