ID: 1081968497_1081968502

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1081968497 1081968502
Species Human (GRCh38) Human (GRCh38)
Location 11:47183564-47183586 11:47183606-47183628
Sequence CCAGAAATACGAGGGGCCCTGCA TCACTCCACACATCCACTGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49} {0: 1, 1: 0, 2: 0, 3: 19, 4: 240}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!