ID: 1081981301_1081981307

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1081981301 1081981307
Species Human (GRCh38) Human (GRCh38)
Location 11:47268991-47269013 11:47269019-47269041
Sequence CCTGTTTTTCCCACAGGGCCCCA AATTCTCCACTGTCACTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 259} {0: 1, 1: 0, 2: 0, 3: 12, 4: 177}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!