ID: 1082040508_1082040513

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1082040508 1082040513
Species Human (GRCh38) Human (GRCh38)
Location 11:47680979-47681001 11:47681031-47681053
Sequence CCATGCACCATCTCACTAAGCAG CAGTAAAAGGAAAATGAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 8, 4: 149} {0: 1, 1: 0, 2: 5, 3: 81, 4: 732}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!