ID: 1082086857_1082086866

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1082086857 1082086866
Species Human (GRCh38) Human (GRCh38)
Location 11:48057536-48057558 11:48057565-48057587
Sequence CCAGAGGCCTTCTCACGTGGGTC GGTGGTGGAGGTGGTGGCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 87} {0: 1, 1: 25, 2: 387, 3: 3398, 4: 8398}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!