ID: 1082767690_1082767700

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1082767690 1082767700
Species Human (GRCh38) Human (GRCh38)
Location 11:57181991-57182013 11:57182035-57182057
Sequence CCCTCCAGCACTGCTGTTGCCTG TGGGCCCAGCTTCCCTGGCCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 427} {0: 1, 1: 0, 2: 7, 3: 44, 4: 437}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!