ID: 1082774247_1082774253

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1082774247 1082774253
Species Human (GRCh38) Human (GRCh38)
Location 11:57233771-57233793 11:57233811-57233833
Sequence CCTCAGAGGGACAATTTCTTCCC AGTGTTCACTGGATGCTTTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 9, 4: 192} {0: 1, 1: 0, 2: 1, 3: 14, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!