ID: 1082785521_1082785530

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1082785521 1082785530
Species Human (GRCh38) Human (GRCh38)
Location 11:57314176-57314198 11:57314221-57314243
Sequence CCAAAGCTCATGTGAGGATCTCC CATAACACCTGCTTTATAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 106} {0: 1, 1: 0, 2: 2, 3: 33, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!