ID: 1082800456_1082800463

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1082800456 1082800463
Species Human (GRCh38) Human (GRCh38)
Location 11:57410336-57410358 11:57410375-57410397
Sequence CCCACTTCTCTCCAACCCCACTG AACTACCATTAACTCAGTCATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 23, 3: 108, 4: 669} {0: 1, 1: 0, 2: 2, 3: 8, 4: 108}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!