ID: 1082846726_1082846730

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1082846726 1082846730
Species Human (GRCh38) Human (GRCh38)
Location 11:57732178-57732200 11:57732199-57732221
Sequence CCTTTTGTCAGCTCATTTTCAGC GCAAAACTTTAGAAGGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 8, 2: 49, 3: 89, 4: 300} {0: 1, 1: 0, 2: 3, 3: 21, 4: 263}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!