ID: 1082854779_1082854783

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1082854779 1082854783
Species Human (GRCh38) Human (GRCh38)
Location 11:57796700-57796722 11:57796729-57796751
Sequence CCAGGTGGCAGTGATAACTATGG GTCCCGGGTGACCCGCATTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 110} {0: 1, 1: 0, 2: 1, 3: 1, 4: 30}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!