ID: 1082862044_1082862050

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1082862044 1082862050
Species Human (GRCh38) Human (GRCh38)
Location 11:57866352-57866374 11:57866392-57866414
Sequence CCTTGTTGCGGAGGCTATAGATG AATTATGATGGTGTAGAAGACGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 3, 3: 15, 4: 195} {0: 1, 1: 0, 2: 1, 3: 26, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!