ID: 1082897138_1082897144

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1082897138 1082897144
Species Human (GRCh38) Human (GRCh38)
Location 11:58204015-58204037 11:58204043-58204065
Sequence CCGTTCCCAACCACAGTGACCAC TACTCAGGAAAAGCACAAAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 32, 4: 324} {0: 1, 1: 0, 2: 3, 3: 26, 4: 248}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!