ID: 1082898143_1082898150

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1082898143 1082898150
Species Human (GRCh38) Human (GRCh38)
Location 11:58214861-58214883 11:58214903-58214925
Sequence CCTCTTTGTGCTTTTCTTGGGTA TGGGAACGGGCTCATCATTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 313} {0: 2, 1: 0, 2: 0, 3: 5, 4: 88}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!