ID: 1082963278_1082963287

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1082963278 1082963287
Species Human (GRCh38) Human (GRCh38)
Location 11:58939536-58939558 11:58939574-58939596
Sequence CCCAATTTTGGCTGGAGAGATAA ACCACAGCTGGCCCCAACCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 189} {0: 1, 1: 0, 2: 1, 3: 32, 4: 264}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!