ID: 1083032271_1083032278

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1083032271 1083032278
Species Human (GRCh38) Human (GRCh38)
Location 11:59604007-59604029 11:59604042-59604064
Sequence CCATCCTCCTTACTCAGAAACAG ACTCTGGAGTTGGACCGGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 44, 4: 314} {0: 1, 1: 0, 2: 0, 3: 7, 4: 65}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!