ID: 1083093143_1083093147

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1083093143 1083093147
Species Human (GRCh38) Human (GRCh38)
Location 11:60221099-60221121 11:60221144-60221166
Sequence CCTGCCATCTTCTGCAGATAACT CTTGCCCTGTTACTGGACTTTGG
Strand - +
Off-target summary {0: 185, 1: 187, 2: 104, 3: 111, 4: 225} {0: 1, 1: 9, 2: 185, 3: 191, 4: 320}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!