ID: 1083104081_1083104085

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1083104081 1083104085
Species Human (GRCh38) Human (GRCh38)
Location 11:60340786-60340808 11:60340823-60340845
Sequence CCTCAAAGACGACTCATGATGCT ATTGACTTCTTGGGAAAAAACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 72} {0: 1, 1: 0, 2: 5, 3: 39, 4: 382}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!