ID: 1083121820_1083121827

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1083121820 1083121827
Species Human (GRCh38) Human (GRCh38)
Location 11:60520678-60520700 11:60520728-60520750
Sequence CCCTGATCTGGCTGTTTTCACAG CACACGGTGCAAGCTGTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 35, 4: 320} {0: 39, 1: 327, 2: 632, 3: 1167, 4: 1415}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!