ID: 1083159910_1083159926

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1083159910 1083159926
Species Human (GRCh38) Human (GRCh38)
Location 11:60848508-60848530 11:60848553-60848575
Sequence CCCCCGCACCTTTCCTCCACTTC AGCCAGGAAGCCCCTGTAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 46, 4: 628} {0: 1, 1: 0, 2: 1, 3: 16, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!