ID: 1083172059_1083172066

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1083172059 1083172066
Species Human (GRCh38) Human (GRCh38)
Location 11:60928949-60928971 11:60928962-60928984
Sequence CCTGACCCTGCGGTGAGCACCAG TGAGCACCAGGCCACGGGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 202} {0: 1, 1: 0, 2: 0, 3: 23, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!