ID: 1083204082_1083204086

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1083204082 1083204086
Species Human (GRCh38) Human (GRCh38)
Location 11:61137532-61137554 11:61137580-61137602
Sequence CCATGCTCACAGTGCTTAATATG CACTGTGCCCAGCACCAGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 161} {0: 1, 1: 2, 2: 11, 3: 113, 4: 693}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!