ID: 1083237323_1083237331

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1083237323 1083237331
Species Human (GRCh38) Human (GRCh38)
Location 11:61359768-61359790 11:61359791-61359813
Sequence CCCAGCACTTTGGGAGGCCCAGG CAGGTGGGTTACCTGAAGTCAGG
Strand - +
Off-target summary {0: 3560, 1: 212195, 2: 267615, 3: 175700, 4: 97562} {0: 2, 1: 68, 2: 2089, 3: 21817, 4: 53546}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!