ID: 1083253071_1083253084

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1083253071 1083253084
Species Human (GRCh38) Human (GRCh38)
Location 11:61481025-61481047 11:61481058-61481080
Sequence CCTGGCCAGGTCAGCCCCTCAGT CCTAGAAGGTCTCAGAAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 355} {0: 1, 1: 0, 2: 2, 3: 25, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!