ID: 1083300660_1083300663

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1083300660 1083300663
Species Human (GRCh38) Human (GRCh38)
Location 11:61738174-61738196 11:61738201-61738223
Sequence CCTGGATGTCCTGCAGCGAAGCA GCCCAAAGTGAGCCCCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107} {0: 1, 1: 0, 2: 1, 3: 21, 4: 165}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!