ID: 1083316466_1083316474

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1083316466 1083316474
Species Human (GRCh38) Human (GRCh38)
Location 11:61817384-61817406 11:61817427-61817449
Sequence CCCTTGAAAGTTGCAGTTATCTT CTCTTGGGCTTGGTGGTGGTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 237} {0: 1, 1: 1, 2: 4, 3: 44, 4: 401}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!