ID: 1083366539_1083366547

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1083366539 1083366547
Species Human (GRCh38) Human (GRCh38)
Location 11:62144954-62144976 11:62144971-62144993
Sequence CCATCTCCCTCGCTCCCCGCCAC CGCCACCCCAGGAGAAGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 76, 4: 1155} {0: 1, 1: 0, 2: 0, 3: 23, 4: 236}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!