ID: 1083399036_1083399048

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1083399036 1083399048
Species Human (GRCh38) Human (GRCh38)
Location 11:62411365-62411387 11:62411405-62411427
Sequence CCCACCCCTCAGAGGGAGCTCAT GCTGGTTCTGCCAGTGGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 180} {0: 1, 1: 1, 2: 1, 3: 23, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!