ID: 1083424316_1083424323

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1083424316 1083424323
Species Human (GRCh38) Human (GRCh38)
Location 11:62575291-62575313 11:62575331-62575353
Sequence CCTGAGCCTCAGTCGCCAGCCAC GCCACCTCCAGCTCCCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 254} {0: 1, 1: 0, 2: 4, 3: 93, 4: 586}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!