ID: 1083484913_1083484924

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1083484913 1083484924
Species Human (GRCh38) Human (GRCh38)
Location 11:62977180-62977202 11:62977218-62977240
Sequence CCACCTGCTCTCCAGGTCCTGCA GCTGGCCCAGGGTCTCTGGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 50, 4: 507} {0: 1, 1: 2, 2: 7, 3: 39, 4: 427}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!