ID: 1083538019_1083538025

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1083538019 1083538025
Species Human (GRCh38) Human (GRCh38)
Location 11:63490072-63490094 11:63490100-63490122
Sequence CCCAGTACCATCTGTTATCACCC CACACCAGCCTTCCCCTTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 191} {0: 1, 1: 0, 2: 4, 3: 27, 4: 314}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!