ID: 1083553397_1083553401

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1083553397 1083553401
Species Human (GRCh38) Human (GRCh38)
Location 11:63607579-63607601 11:63607599-63607621
Sequence CCTGAGCACCTGAGATTTTTGTT GTTTCGGTCTTGAAAGATGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 21, 4: 297} {0: 1, 1: 0, 2: 0, 3: 18, 4: 133}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!